HPV6 E6

Accession: H002803

Protein: E6

Organism: Human papillomavirus type 6

Function

It is an oncogenic protein which causes transformation of host cell by binding to p53 tumour suppressor protein. For binding, it requires E6-associated protein (E6-AP) which is involved in the ubiquitin ligase pathway. E6-AP binds ubiquitin to the p53 pro

Mutation

103-200

201-300

301-400

401-500

501-555

Legend:same sensemissenseinsertiondeletion

Mutation type	Position	DESC	Disease	Reference
same sense	132	A → G	Disease: Condyloma acuminate Region : Sichuan	Ref
missense	252	G → C (Q → H)	Disease: Condyloma acuminate Region : Sichuan	Ref
same sense	324	T → A	Disease: Condyloma acuminate Region : Sichuan	Ref
same sense	366	T → A	Disease: Condyloma acuminate Region : Sichuan	Ref
same sense	393	T → C	Disease: Condyloma acuminate Region : Sichuan	Ref
missense	475	C → G (R → G)	Disease: Condyloma acuminate Region : Sichuan	Ref
same sense	489	A → G	Disease: Condyloma acuminate Region : Sichuan	Ref

show more details

Domain&Motif

method	domain/motif name	position	length	description
CDD	PHA02779	103-552	450	E6 protein; Provisional
CDD	E6	193-522	330	Early Protein (E6);
CDD	PHA02775	136-522	387	E6; Provisional
MOTIF_SCAN		115-126	12
MOTIF_SCAN		163-174	12
MOTIF_SCAN		490-501	12
MOTIF_SCAN		133-144	12
MOTIF_SCAN		217-228	12
MOTIF_SCAN		361-372	12
MOTIF_SCAN		379-390	12
MOTIF_SCAN		529-540	12
MOTIF_SCAN		496-504	9
MOTIF_SCAN		334-357	24
MOTIF_SCAN		193-522	330
MOTIF_SCAN		193-522	330
INTERPROSCAN		193-522	330
MOTIF_SEAR_IN_PROT		103-552	450
MOTIF_SEAR_IN_PROT		193-522	330
MOTIF_SEAR_IN_PROT		136-522	387
MOTIF_SEAR_IN_PROT		133-213	81
MOTIF_SEAR_IN_PROT		217-417	201
MOTIF_SEAR_IN_PROT		349-465	117
MOTIF_SEAR_IN_PROT		193-522	330
MOTIF_SEAR_IN_PROT		190-249	60
PROSITE_SCAN		115-126	12
PROSITE_SCAN		133-144	12
PROSITE_SCAN		163-174	12
PROSITE_SCAN		217-228	12
PROSITE_SCAN		334-357	24
PROSITE_SCAN		361-372	12
PROSITE_SCAN		379-390	12
PROSITE_SCAN		490-501	12
PROSITE_SCAN		496-504	9
PROSITE_SCAN		529-540	12
SBASE		103-183	81
SBASE		193-522	330
TMPRED_SERVER		262-315	54
TMPRED_SERVER		262-321	60

Sequence

         .         .         .         .         .         .　　　　　G:162
atggaaagtgcaaatgcctccacgtctgcaacgaccatagaccagttgtgcaagacgttt　　　　　C:60
 M  E  S  A  N  A  S  T  S  A  T  T  I  D  Q  L  C  K  T  F 　　　　　P:20


         .         .         .         .         .         .　　　　　G:222
aatctatctatgcatacgttgcaaattaattgtgtgttttgcaagaatgcactgaccact　　　　　C:60
 N  L  S  M  H  T  L  Q  I  N  C  V  F  C  K  N  A  L  T  T 　　　　　P:20


         .         .         .         .         .         .　　　　　G:282
gcagagatttattcatatgcatataaacagctaaaggtcctgtttcgaggcggctatcca　　　　　C:60
 A  E  I  Y  S  Y  A  Y  K  Q  L  K  V  L  F  R  G  G  Y  P 　　　　　P:20


         .         .         .         .         .         .　　　　　G:342
tatgcagcctgcgcgtgctgcctagaatttcatggaaaaattaaccaatatagacacttt　　　　　C:60
 Y  A  A  C  A  C  C  L  E  F  H  G  K  I  N  Q  Y  R  H  F 　　　　　P:20


         .         .         .         .         .         .　　　　　G:402
gattatgctggatatgcaacaactgttgaagaagaaactaaacaagacattttagacgtg　　　　　C:60
 D  Y  A  G  Y  A  T  T  V  E  E  E  T  K  Q  D  I  L  D  V 　　　　　P:20


         .         .         .         .         .         .　　　　　G:462
ctaattcggtgctacctgtgtcacaaaccgctgtgtgaagtagaaaaggtaaaacatata　　　　　C:60
 L  I  R  C  Y  L  C  H  K  P  L  C  E  V  E  K  V  K  H  I 　　　　　P:20


         .         .         .         .         .         .　　　　　G:522
ctaaccaaggcacggttcataaagctaaattgtacgtggaagggtcgctgcctacactgc　　　　　C:60
 L  T  K  A  R  F  I  K  L  N  C  T  W  K  G  R  C  L  H  C 　　　　　P:20


         .         .         .                              　　　　　G:555
tggacaacatgcatggaagacatgttaccctaa                           　　　　　C:33
 W  T  T  C  M  E  D  M  L  P                               　　　　　P:10

Legend:gene mutationamino acid mutation

DETAIL

DOMAIN & MUTATION