HPV59 E6

Accession: H001272

Uniprot: Q81964

Protein: E6

Organism: Human papillomavirus type 59

Function

It is an oncogenic protein which causes transformation of host cell by binding to p53 tumour suppressor protein. For binding, it requires E6-associated protein (E6-AP) which is involved in the ubiquitin ligase pathway. E6-AP binds ubiquitin to the p53 pro

Mutation

55-100

101-200

201-300

301-400

401-500

501-537

Legend:same sensemissenseinsertiondeletion

Mutation type	Position	DESC	Disease	Reference
same sense	102	T → C	Disease: Cervical carcinoma Region : Sichuan	Ref
same sense	306	C → T	Disease: Cervical carcinoma Region : Sichuan	Ref
same sense	363	A → C	Disease: Cervical carcinoma Region : Sichuan	Ref
same sense	402	T → C	Disease: Cervical carcinoma Region : Sichuan	Ref

show more details

Domain&Motif

method	domain/motif name	position	length	description
CDD	E6	148-477	330	Early Protein (E6);
CDD	PHA02779	94-477	384	E6 protein; Provisional
CDD	PHA02775	85-477	393	E6; Provisional
MOTIF_SCAN		448-465	18
MOTIF_SCAN		76-84	9
MOTIF_SCAN		397-405	9
MOTIF_SCAN		418-426	9
MOTIF_SCAN		274-297	24
MOTIF_SCAN		148-477	330
MOTIF_SCAN		148-477	330
INTERPROSCAN		148-477	330
MOTIF_SEAR_IN_PROT		148-477	330
MOTIF_SEAR_IN_PROT		94-486	393
MOTIF_SEAR_IN_PROT		85-477	393
MOTIF_SEAR_IN_PROT		103-213	111
MOTIF_SEAR_IN_PROT		145-237	93
MOTIF_SEAR_IN_PROT		145-243	99
MOTIF_SEAR_IN_PROT		148-477	330
PROSITE_SCAN		76-84	9
PROSITE_SCAN		274-297	24
PROSITE_SCAN		397-405	9
PROSITE_SCAN		418-426	9
PROSITE_SCAN		448-465	18
SBASE		148-477	330
RADAR		238-300	63
RADAR		310-375	66
TMPRED_SERVER		250-309	60

Sequence

         .         .         .         .         .         .　　　　　G:114
atggcacgctttgaggatcctacacaacgaccatacaaactgcctgatttgagcacaaca　　　　　C:60
 M  A  R  F  E  D  P  T  Q  R  P  Y  K  L  P  D  L  S  T  T 　　　　　P:20


         .         .         .         .         .         .　　　　　G:174
ttgaatattcctctgcatgatattcgcatcaattgtgtgttttgcaaaggggaactgcaa　　　　　C:60
 L  N  I  P  L  H  D  I  R  I  N  C  V  F  C  K  G  E  L  Q 　　　　　P:20


         .         .         .         .         .         .　　　　　G:234
gaaagagaggtatttgaatttgcttttaatgacttatttatagtgtatagagactgtaca　　　　　C:60
 E  R  E  V  F  E  F  A  F  N  D  L  F  I  V  Y  R  D  C  T 　　　　　P:20


         .         .         .         .         .         .　　　　　G:294
ccgtatgcagcgtgtctgaaatgcatttcattttatgcaagagtaagagaattaagatat　　　　　C:60
 P  Y  A  A  C  L  K  C  I  S  F  Y  A  R  V  R  E  L  R  Y 　　　　　P:20


         .         .         .         .         .         .　　　　　G:354
tatagagattccgtgtatggagaaacattagaggctgaaaccaagacaccgttacatgag　　　　　C:60
 Y  R  D  S  V  Y  G  E  T  L  E  A  E  T  K  T  P  L  H  E 　　　　　P:20


         .         .         .         .         .         .　　　　　G:414
ctgctgatacgctgttatagatgcctaaaacctctatgtccaacagataaattaaagcat　　　　　C:60
 L  L  I  R  C  Y  R  C  L  K  P  L  C  P  T  D  K  L  K  H 　　　　　P:20


         .         .         .         .         .         .　　　　　G:474
ataactgaaaaaagaagattccataatatagctggaatatatacaggacagtgtcgtggg　　　　　C:60
 I  T  E  K  R  R  F  H  N  I  A  G  I  Y  T  G  Q  C  R  G 　　　　　P:20


         .         .         .         .         .         .　　　　　G:534
tgtcggacccgagcaagacacctaagacagcaacgacaagcgcgtagtgaaacactggtg　　　　　C:60
 C  R  T  R  A  R  H  L  R  Q  Q  R  Q  A  R  S  E  T  L  V 　　　　　P:20


                                                            　　　　　G:537
taa                                                         　　　　　C:3
                                                            　　　　　P:0

Legend:gene mutationamino acid mutation

DETAIL

DOMAIN & MUTATION