HPV52 E7

Accession: H000104

NC: LC270063.1

Uniprot: P36831

Protein: E7

Organism: Human papillomavirus type 52

Function

E7 protein is transforming protein. It binds to pRB/p107 and promotes its complete degradation.

Mutation

553-600

601-700

701-800

801-852

Legend:same sensemissenseinsertiondeletion

Mutation type	Position	DESC	Disease	Reference
same sense	573	T → A	Disease: Cervical carcinoma Region : Beijing	Ref
same sense	582	T → G	Disease: Cervical carcinoma Region : Beijing	Ref
same sense	662	C → T	Disease: Cervical carcinoma Region : Beijing	Ref
same sense	706	A → G	Disease: Cervical carcinoma Region : Beijing	Ref
same sense	707	G → A	Disease: Cervical carcinoma Region : Beijing	Ref
same sense	727	T → G	Disease: Cervical carcinoma Region : Beijing	Ref
same sense	742	G → A	Disease: Cervical carcinoma Region : Beijing	Ref
same sense	751	C → T	hot spot Disease: Cervical carcinoma Region : Beijing	Ref
same sense	801	A → G	hot spot Disease: Cervical carcinoma Region : Beijing	Ref

show more details

Domain&Motif

method	domain/motif name	position	length	description
CDD	E7	559-843	285	E7 protein, Early protein;
CDD	PHA02776	553-843	291	E7 protein; Provisional
CDD	Adeno_E1A	583-726	144	Early E1A protein; This is a family of adenovirus early E1A proteins.
CDD	PHA02624	613-726	114	large T antigen; Provisional
MOTIF_SCAN		571-582	12
MOTIF_SCAN		643-654	12
MOTIF_SCAN		772-783	12
MOTIF_SCAN		841-849	9
MOTIF_SCAN		571-579	9
MOTIF_SCAN		748-756	9
MOTIF_SCAN		556-564	9
MOTIF_SCAN		559-843	285
MOTIF_SCAN		559-843	285
INTERPROSCAN		553-849	297
INTERPROSCAN		559-840	282
MOTIF_SEAR_IN_PROT		559-843	285
MOTIF_SEAR_IN_PROT		553-843	291
MOTIF_SEAR_IN_PROT		613-726	114
MOTIF_SEAR_IN_PROT		583-726	144
MOTIF_SEAR_IN_PROT		748-825	78
MOTIF_SEAR_IN_PROT		559-840	282
MOTIF_SEAR_IN_PROT		727-840	114
PROSITE_SCAN		556-564	9
PROSITE_SCAN		571-579	9
PROSITE_SCAN		571-582	12
PROSITE_SCAN		643-654	12
PROSITE_SCAN		748-756	9
PROSITE_SCAN		772-783	12
PROSITE_SCAN		841-849	9
SBASE		553-843	291
TMPRED_SERVER		796-849	54
TMPRED_SERVER		796-852	57
UNIPROTKB		730-840	111
UNIPROTKB		616-630	15
UNIPROTKB		784-810	27
UNIPROTKB		553-678	126

Sequence

         .         .         .         .         .         .　　　　　G:612
atgcgtggagacaaagcaactataaaagattatatattagatctgcaacctgaaacaact　　　　　C:60
 M  R  G  D  K  A  T  I  K  D  Y  I  L  D  L  Q  P  E  T  T 　　　　　P:20


         .         .         .         .         .         .　　　　　G:672
gacctacactgctatgagcaattaggtgacagctcagatgaggaggatacagatggtgtg　　　　　C:60
 D  L  H  C  Y  E  Q  L  G  D  S  S  D  E  E  D  T  D  G  V 　　　　　P:20


         .         .         .         .         .         .　　　　　G:732
gaccggccagatggacaagcagaacaagccacaagcaattactacattgtgacatattgt　　　　　C:60
 D  R  P  D  G  Q  A  E  Q  A  T  S  N  Y  Y  I  V  T  Y  C 　　　　　P:20


         .         .         .         .         .         .　　　　　G:792
cacagttgtgatagcacactacggctatgcattcatagcactgcgacggaccttcgtact　　　　　C:60
 H  S  C  D  S  T  L  R  L  C  I  H  S  T  A  T  D  L  R  T 　　　　　P:20


                                                            　　　　　G:852
ctacagcaaatgctgttgggcacattacaagttgtgtgccccggctgtgcacggctataa　　　　　C:0
 L  Q  Q  M  L  L  G  T  L  Q  V  V  C  P  G  C  A  R  L    　　　　　P:19

Legend:gene mutationamino acid mutation

DETAIL

DOMAIN & MUTATION