HPV52 E6

Accession: H000082

NC: AEI61550.1

Uniprot: P36814

Protein: E6

Organism: Human papillomavirus type 52

Function

It is an oncogenic protein which causes transformation of host cell by binding to p53 tumour suppressor protein. For binding, it requires E6-associated protein (E6-AP) which is involved in the ubiquitin ligase pathway. E6-AP binds ubiquitin to the p53 pro

Mutation

102-200

201-300

301-400

401-500

501-548

Legend:same sensemissenseinsertiondeletion

Mutation type	Position	DESC	Disease	Reference
same sense	180	A → C	Disease: Cervical carcinoma Region : Beijing	Ref
same sense	338	T → C	Disease: Cervical carcinoma Region : Beijing	Ref
same sense	350	G → T	hot spot Disease: Cervical carcinoma Region : Sichuan, Beijing	Ref
same sense	356	G → A	hot spot Disease: Cervical carcinoma Region : Beijing	Ref
same sense	356	A → G	Disease: Cervical carcinoma Region : Sichuan	Ref
missense	378	A → C (K → R)	Disease: Cervical carcinoma Region : Sichuan	Ref
missense	379	A → G (K → R)	hot spot Disease: Cervical carcinoma Region : Sichuan, Beijing	Ref
same sense	404	T → C	Disease: Cervical carcinoma Region : Beijing	Ref
missense	467	C → A (N → K)	Disease: Cervical carcinoma Region : Sichuan	Ref
same sense	530	A → G	Disease: Cervical carcinoma Region : Beijing	Ref

show more details

Domain&Motif

method	domain/motif name	position	length	description
CDD	E6	189-518	330	Early Protein (E6);
CDD	PHA02779	117-524	408	E6 protein; Provisional
CDD	PHA02775	126-518	393	E6; Provisional
MOTIF_SCAN		132-143	12
MOTIF_SCAN		165-176	12
MOTIF_SCAN		360-371	12
MOTIF_SCAN		399-407	9
MOTIF_SCAN		498-506	9
MOTIF_SCAN		315-338	24
MOTIF_SCAN		345-392	48
MOTIF_SCAN		189-518	330
MOTIF_SCAN		189-518	330
MOTIF_SCAN		351-392	42
INTERPROSCAN		189-518	330
MOTIF_SEAR_IN_PROT		189-518	330
MOTIF_SEAR_IN_PROT		117-524	408
MOTIF_SEAR_IN_PROT		126-518	393
MOTIF_SEAR_IN_PROT		135-326	192
MOTIF_SEAR_IN_PROT		189-260	72
MOTIF_SEAR_IN_PROT		189-518	330
MOTIF_SEAR_IN_PROT		144-230	87
MOTIF_SEAR_IN_PROT		471-536	66
PROSITE_SCAN		132-143	12
PROSITE_SCAN		165-176	12
PROSITE_SCAN		315-338	24
PROSITE_SCAN		360-371	12
PROSITE_SCAN		399-407	9
PROSITE_SCAN		498-506	9
SBASE		189-518	330
RADAR		366-428	63
RADAR		465-527	63
RADAR		189-233	45
RADAR		288-332	45
UNIPROTKB		189-299	111
UNIPROTKB		408-518	111

Sequence

         .         .         .         .         .         .　　　　　G:161
atgtttgaggatccagcaacacgaccccggaccctgcacgaattgtgtgaggtgctggaa　　　　　C:60
 M  F  E  D  P  A  T  R  P  R  T  L  H  E  L  C  E  V  L  E 　　　　　P:20


         .         .         .         .         .         .　　　　　G:221
gaatcggtgcatgaaataaggctgcagtgtgtgcagtgcaaaaaagagctacaacgaaga　　　　　C:60
 E  S  V  H  E  I  R  L  Q  C  V  Q  C  K  K  E  L  Q  R  R 　　　　　P:20


         .         .         .         .         .         .　　　　　G:281
gaggtatacaagtttctatttacagatttacgaatagtatatagagacaataatccatat　　　　　C:60
 E  V  Y  K  F  L  F  T  D  L  R  I  V  Y  R  D  N  N  P  Y 　　　　　P:20


         .         .         .         .         .         .　　　　　G:341
ggcgtgtgtattatgtgcctacgctttttatctaagataagtgaatataggcattatcaa　　　　　C:60
 G  V  C  I  M  C  L  R  F  L  S  K  I  S  E  Y  R  H  Y  Q 　　　　　P:20


         .         .         .         .         .         .　　　　　G:401
tattcactgtatgggaaaacattagaagagagggtaaaaaaaccattaagtgaaataact　　　　　C:60
 Y  S  L  Y  G  K  T  L  E  E  R  V  K  K  P  L  S  E  I  T 　　　　　P:20


         .         .         .         .         .         .　　　　　G:461
attagatgtataatttgtcaaacgccattatgtcctgaagaaaaagaaagacatgttaat　　　　　C:60
 I  R  C  I  I  C  Q  T  P  L  C  P  E  E  K  E  R  H  V  N 　　　　　P:20


         .         .         .         .         .         .　　　　　G:521
gcaaacaagcgatttcataatattatgggtcgttggacagggcgctgttcagagtgttgg　　　　　C:60
 A  N  K  R  F  H  N  I  M  G  R  W  T  G  R  C  S  E  C  W 　　　　　P:20


         .         .                                        　　　　　G:548
agaccccgacctgtgacccaagtgtaa                                 　　　　　C:27
 R  P  R  P  V  T  Q  V                                     　　　　　P:8

Legend:gene mutationamino acid mutation

DETAIL

DOMAIN & MUTATION