HPV18 E6

Accession: H000070

NC: NP_040310.1

Uniprot: P06463

Protein: E6

Organism: Human papillomavirus type 18

Function

It is an oncogenic protein which causes transformation of host cell by binding to p53 tumour suppressor protein. For binding, it requires E6-associated protein (E6-AP) which is involved in the ubiquitin ligase pathway. E6-AP binds ubiquitin to the p53 pro

Mutation

105-200

201-300

301-400

401-500

501-581

Legend:same sensemissenseinsertiondeletion

Mutation type	Position	DESC	Disease	Reference
same sense	218	A → T	Disease: Cervical carcinoma Region : Southwest China	Ref
same sense	485	T → C	Disease: Cervical carcinoma Region : Southwest China, Sichuan	Ref
same sense	549	C → A	Disease: Cervical carcinoma Region : Southwest China, Sichuan	Ref

show more details

Domain&Motif

method	domain/motif name	position	length	description
CDD	E6	198-527	330	Early Protein (E6);
CDD	PHA02779	144-527	384	E6 protein; Provisional
CDD	PHA02775	135-527	393	E6; Provisional
MOTIF_SCAN		168-179	12
MOTIF_SCAN		561-572	12
MOTIF_SCAN		174-185	12
MOTIF_SCAN		213-224	12
MOTIF_SCAN		510-527	18
MOTIF_SCAN		126-134	9
MOTIF_SCAN		324-347	24
MOTIF_SCAN		198-527	330
MOTIF_SCAN		456-515	60
MOTIF_SCAN		198-527	330
INTERPROSCAN		198-527	330
MOTIF_SEAR_IN_PROT		198-527	330
MOTIF_SEAR_IN_PROT		144-527	384
MOTIF_SEAR_IN_PROT		135-527	393
MOTIF_SEAR_IN_PROT		306-401	96
MOTIF_SEAR_IN_PROT		414-539	126
MOTIF_SEAR_IN_PROT		186-335	150
MOTIF_SEAR_IN_PROT		531-575	45
MOTIF_SEAR_IN_PROT		132-224	93
MOTIF_SEAR_IN_PROT		135-233	99
MOTIF_SEAR_IN_PROT		198-527	330
PROSITE_SCAN		126-134	9
PROSITE_SCAN		168-179	12
PROSITE_SCAN		174-185	12
PROSITE_SCAN		213-224	12
PROSITE_SCAN		324-347	24
PROSITE_SCAN		510-527	18
PROSITE_SCAN		561-572	12
SBASE		198-527	330
RADAR		414-473	60
RADAR		513-569	57
UNIPROTKB		198-308	111
UNIPROTKB		417-527	111
UNIPROTKB		567-578	12

Sequence

         .         .         .         .         .         .　　　　　G:164
atggcgcgctttgaggatccaacacggcgaccctacaagctacctgatctgtgcacggaa　　　　　C:60
 M  A  R  F  E  D  P  T  R  R  P  Y  K  L  P  D  L  C  T  E 　　　　　P:20


         .         .         .         .         .         .　　　　　G:224
ctgaacacttcactgcaagacatagaaataacctgtgtatattgcaagacagtattggaa　　　　　C:60
 L  N  T  S  L  Q  D  I  E  I  T  C  V  Y  C  K  T  V  L  E 　　　　　P:20


         .         .         .         .         .         .　　　　　G:284
cttacagaggtatttgaatttgcatttaaagatttatttgtggtgtatagagacagtata　　　　　C:60
 L  T  E  V  F  E  F  A  F  K  D  L  F  V  V  Y  R  D  S  I 　　　　　P:20


         .         .         .         .         .         .　　　　　G:344
ccgcatgctgcatgccataaatgtatagatttttattctagaattagagaattaagacat　　　　　C:60
 P  H  A  A  C  H  K  C  I  D  F  Y  S  R  I  R  E  L  R  H 　　　　　P:20


         .         .         .         .         .         .　　　　　G:404
tattcagactctgtgtatggagacacattggaaaaactaactaacactgggttatacaat　　　　　C:60
 Y  S  D  S  V  Y  G  D  T  L  E  K  L  T  N  T  G  L  Y  N 　　　　　P:20


         .         .         .         .         .         .　　　　　G:464
ttattaataaggtgcctgcggtgccagaaaccgttgaatccagcagaaaaacttagacac　　　　　C:60
 L  L  I  R  C  L  R  C  Q  K  P  L  N  P  A  E  K  L  R  H 　　　　　P:20


         .         .         .         .         .         .　　　　　G:524
cttaatgaaaaacgacgatttcacaacatagctgggcactatagaggccagtgccattcg　　　　　C:60
 L  N  E  K  R  R  F  H  N  I  A  G  H  Y  R  G  Q  C  H  S 　　　　　P:20


         .         .         .         .         .          　　　　　G:581
tgctgcaaccgagcacgacaggaacgactccaacgacgcagagaaacacaagtataa   　　　　　C:57
 C  C  N  R  A  R  Q  E  R  L  Q  R  R  R  E  T  Q  V       　　　　　P:18

Legend:gene mutationamino acid mutation

DETAIL

DOMAIN & MUTATION