HPV58 E5
Accession: H000067
Uniprot: P26552
Protein: E5
Organism: Human papillomavirus type 58
Function
It obstructs the growth suppression mechanisms: e.g. EGF receptor; activates mitogenic signalling pathways via transcription factors: c-Jun and c-Fos (important in ubiquitin pathway degradation of p53 complex by E6). Also inactivates p21 protein (p53 indu
Domain&Motif
| method | domain/motif name | position | length | description | graphical view |
|---|---|---|---|---|---|
| CDD | Papilloma_E5 | 3955-4113 | 159 | Papillomavirus E5; The E5 protein from papillomaviruses is about 80 amino acids long. The proteins are contain three regions that are predicted to be transmembrane alpha helices. The function of this protein is unknown. | |
| MOTIF_SCAN | 4108-4119 | 12 | |||
| MOTIF_SCAN | 3895-4113 | 219 | |||
| MOTIF_SCAN | 3895-4113 | 219 | |||
| MOTIF_SEAR_IN_PROT | 3895-4113 | 219 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| MOTIF_SEAR_IN_PROT | 3973-4026 | 54 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| MOTIF_SEAR_IN_PROT | 3967-4044 | 78 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| MOTIF_SEAR_IN_PROT | 3919-4116 | 198 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| MOTIF_SEAR_IN_PROT | 3955-4086 | 132 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| MOTIF_SEAR_IN_PROT | 3967-4044 | 78 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| MOTIF_SEAR_IN_PROT | 3922-4014 | 93 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| MOTIF_SEAR_IN_PROT | 3895-4113 | 219 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| MOTIF_SEAR_IN_PROT | 3898-4092 | 195 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| PROSITE_SCAN | 4108-4119 | 12 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| SBASE | 3952-4113 | 162 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| RADAR | 3898-3933 | 36 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| RADAR | 4033-4065 | 33 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| TMPRED_SERVER | 3895-3954 | 60 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| TMPRED_SERVER | 3961-4014 | 54 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| TMPRED_SERVER | 3964-4020 | 57 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 | ||
| TMPRED_SERVER | 4009-4062 | 54 | Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465 |
Sequence
. . . . . . G:3951
atgatattacctatttttgttgtttgttttatactgtttttatgcttgtgcatttttttg C:60
M I L P I F V V C F I L F L C L C I F L P:20
. . . . . . G:4011
cggccattggtgctatctatttctatatatgcttggttgctggtgttggtgttgctgctt C:60
R P L V L S I S I Y A W L L V L V L L L P:20
. . . . . . G:4071
tgggtgtctgtggggtcggctctacgaatttttttctgttacttaatatttttatatata C:60
W V S V G S A L R I F F C Y L I F L Y I P:20
. . . . . G:4122
ccaatgatgtgtattaattttcatgcacaatacttaacccaacaagactaa C:51
P M M C I N F H A Q Y L T Q Q D P:16