HPV18 E5

Accession: H000060

NC: NP_040315.1

Uniprot: P06792

Protein: E5

Organism: Human papillomavirus type 18

Function

It obstructs the growth suppression mechanisms: e.g. EGF receptor; activates mitogenic signalling pathways via transcription factors: c-Jun and c-Fos (important in ubiquitin pathway degradation of p53 complex by E6). Also inactivates p21 protein (p53 indu

Domain&Motif

method	domain/motif name	position	length	description
CDD	Papilloma_E5	3939-4154	216	Papillomavirus E5; The E5 protein from papillomaviruses is about 80 amino acids long. The proteins are contain three regions that are predicted to be transmembrane alpha helices. The function of this protein is unknown.
MOTIF_SCAN		3960-4022	63
MOTIF_SCAN		3939-4154	216
MOTIF_SCAN		3939-4154	216
INTERPROSCAN		3939-4154	216
MOTIF_SEAR_IN_PROT		3939-4154	216
MOTIF_SEAR_IN_PROT		4017-4133	117
MOTIF_SEAR_IN_PROT		3939-4154	216
SBASE		3948-4154	207
RADAR		3948-3995	48
RADAR		4089-4133	45
TMPRED_SERVER		3939-3992	54
TMPRED_SERVER		3939-3995	57
TMPRED_SERVER		4011-4061	51
TMPRED_SERVER		4041-4094	54
TMPRED_SERVER		4053-4115	63
TMPRED_SERVER		4083-4139	57

Sequence

         .         .         .         .         .         .　　　　　G:3995
atgttatcacttatttttttattttgcttttgtgtatgcatgtatgtgtgctgccatgtc　　　　　C:60
 M  L  S  L  I  F  L  F  C  F  C  V  C  M  Y  V  C  C  H  V 　　　　　P:20


         .         .         .         .         .         .　　　　　G:4055
ccgcttttgccatctgtctgtatgtgtgcgtatgcatgggtattggtatttgtgtatatt　　　　　C:60
 P  L  L  P  S  V  C  M  C  A  Y  A  W  V  L  V  F  V  Y  I 　　　　　P:20


         .         .         .         .         .         .　　　　　G:4115
gtggtaataacgtcccctgccacagcattcacagtatatgtattttgttttttattgccc　　　　　C:60
 V  V  I  T  S  P  A  T  A  F  T  V  Y  V  F  C  F  L  L  P 　　　　　P:20


         .         .         .         .                    　　　　　G:4157
atgttactattgcatatacatgctatattgtctttacagtaa                  　　　　　C:42
 M  L  L  L  H  I  H  A  I  L  S  L  Q                      　　　　　P:13

DETAIL

DOMAIN & MUTATION