HPV16 E5

Accession: H000059

NC: KY994539.1

Uniprot: P06927

Protein: E5

Organism: Human papillomavirus type 16

Function

It obstructs the growth suppression mechanisms: e.g. EGF receptor; activates mitogenic signalling pathways via transcription factors: c-Jun and c-Fos (important in ubiquitin pathway degradation of p53 complex by E6). Also inactivates p21 protein (p53 indu

Mutation

3850-3900

3901-4000

4001-4100

4101-4101

Legend:same sensemissenseinsertiondeletion

Mutation type	Position	DESC	Disease	Reference
missense	3868	G → A (A → P)	Disease: Cervical carcinoma Region : Hubei	Ref
same sense	3883	C → T	Disease: Cervical carcinoma Region : Hubei	Ref
missense	3978	A → C (I → L)	Disease: Cervical carcinoma Region : Tianjin, Xinjiang Nation : Uygur,Han	Ref
missense	3979	A → C (I → L)	hot spot Disease: Cervical carcinoma Region : Shandong, Hubei	Ref
same sense	3991	C → T	Disease: Cervical carcinoma Region : Hubei	Ref
missense	4041	A → G (I → V)	Disease: Cervical carcinoma Region : Tianjin	Ref
missense	4042	A → G (I → V)	hot spot Disease: Cervical carcinoma Region : Shandong, Hubei, Xinjiang Nation : Uygur,Han	Ref
same sense	4047	A → T	Disease: Cervical carcinoma Region : Tianjin	Ref
same sense	4071	A → C	Disease: Cervical carcinoma Region : Shandong	Ref
same sense	4077	A → T	hot spot Disease: Cervical carcinoma Region : Shandong	Ref
same sense	4090	T → C	Disease: Cervical carcinoma Region : Shandong	Ref

show more details

Domain&Motif

method	domain/motif name	position	length	description	graphical view
CDD	Papilloma_E5	3951-4097	147	Papillomavirus E5; The E5 protein from papillomaviruses is about 80 amino acids long. The proteins are contain three regions that are predicted to be transmembrane alpha helices. The function of this protein is unknown.
MOTIF_SCAN		3852-3863	12
MOTIF_SCAN		3879-3995	117
MOTIF_SCAN		3879-4097	219
MOTIF_SCAN		3879-4097	219
INTERPROSCAN		3879-4094	216		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
MOTIF_SEAR_IN_PROT		3879-4097	219		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
MOTIF_SEAR_IN_PROT		3894-4007	114		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
MOTIF_SEAR_IN_PROT		3876-3995	120		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
MOTIF_SEAR_IN_PROT		3894-4013	120		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
MOTIF_SEAR_IN_PROT		3879-4094	216		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
PROSITE_SCAN		3852-3863	12		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
SBASE		3951-4097	147		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
RADAR		3900-3980	81		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
RADAR		4023-4094	72		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
TMPRED_SERVER		3879-3938	60		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
TMPRED_SERVER		3882-3935	54		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
TMPRED_SERVER		3990-4046	57		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
TMPRED_SERVER		3990-4052	63		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465

Sequence

         .         .         .         .         .         .　　　　　G:3909
atgacaaatcttgatactgcatccacaacattactggcgtgctttttgctttgcttttgt　　　　　C:60
 M  T  N  L  D  T  A  S  T  T  L  L  A  C  F  L  L  C  F  C 　　　　　P:20


         .         .         .         .         .         .　　　　　G:3969
gtgcttttgtgtgtctgcctattaatacgtccgctgcttttgtctgtgtctacatacaca　　　　　C:60
 V  L  L  C  V  C  L  L  I  R  P  L  L  L  S  V  S  T  Y  T 　　　　　P:20


         .         .         .         .         .         .　　　　　G:4029
tcattaataatattggtattactattgtggataacagcagcctctgcgtttaggtgtttt　　　　　C:60
 S  L  I  I  L  V  L  L  L  W  I  T  A  A  S  A  F  R  C  F 　　　　　P:20


         .         .         .         .         .         .　　　　　G:4089
attgtatatattatatttgtttatataccattatttttaatacatacacatgcacgcttt　　　　　C:60
 I  V  Y  I  I  F  V  Y  I  P  L  F  L  I  H  T  H  A  R  F 　　　　　P:20


         .                                                  　　　　　G:4101
ttaattacataa                                                　　　　　C:12
 L  I  T                                                    　　　　　P:3

Legend:gene mutationamino acid mutation

DETAIL

DOMAIN & MUTATION