HPV58 E4

Accession: H000056

Uniprot: P26549

Protein: E4

Organism: Human papillomavirus type 58

Function

It is responsible for recognition and binding of origin of replication. It exists in two forms such as full length (transcriptional transactivator) and truncated (transcriptional repressor). The ratio of these found in the heterotrimeric complex, formed b

Domain&Motif

method	domain/motif name	position	length	description	graphical view
CDD	Pap_E4	3420-3593	174	E4 protein; This is is a family of Papillomavirus proteins, E4, coded for by ORF4. A splice variant, E1--E4, exists but neither the function of E4 or E1--E4 is known.
MOTIF_SCAN		3432-3443	12
MOTIF_SCAN		3384-3392	9
MOTIF_SCAN		3408-3416	9
MOTIF_SCAN		3339-3593	255
INTERPROSCAN		3339-3593	255
INTERPROSCAN		3895-4113	219		Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 459 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 462 Warning: Division by zero in E:\tomcat\apache-tomcat-8.0.36\webapps\hpv\domain_detail.php on line 465
MOTIF_SEAR_IN_PROT		3339-3593	255
MOTIF_SEAR_IN_PROT		3330-3593	264
MOTIF_SEAR_IN_PROT		3447-3536	90
MOTIF_SEAR_IN_PROT		3339-3593	255
PROSITE_SCAN		3384-3392	9
PROSITE_SCAN		3408-3416	9
PROSITE_SCAN		3432-3443	12
SBASE		3339-3593	255

Sequence

         .         .         .         .         .         .　　　　　G:3389
ttgtatgtcctacatctatacctagtgatcaaatatccactactgaaactgctgacccaa　　　　　C:60
 L  Y  V  L  H  L  Y  L  V  I  K  Y  P  L  L  K  L  L  T  Q 　　　　　P:20


         .         .         .         .         .         .　　　　　G:3449
agaccaccgaggccaccaacaacgaaagtacacaggggacaaagcgacgacgactcgatt　　　　　C:60
 R  P  P  R  P  P  T  T  K  V  H  R  G  Q  S  D  D  D  S  I 　　　　　P:20


         .         .         .         .         .         .　　　　　G:3509
taccagactccagagacaacacccagtactccacaaagtatacagactgcgccgtggaca　　　　　C:60
 Y  Q  T  P  E  T  T  P  S  T  P  Q  S  I  Q  T  A  P  W  T 　　　　　P:20


         .         .         .         .         .         .　　　　　G:3569
gtagaccacgaggaggaggactacacagtacaactaactgtacatacaaagggcggaacg　　　　　C:60
 V  D  H  E  E  E  D  Y  T  V  Q  L  T  V  H  T  K  G  G  T 　　　　　P:20


         .         .         .                              　　　　　G:3605
tgtgtagttctaaagtttcacctatcgtgcatttaa                        　　　　　C:36
 C  V  V  L  K  F  H  L  S  C  I                            　　　　　P:11

DETAIL

DOMAIN & MUTATION