HPV18 E4

Accession: H000048

NC: NP_040314.1

Uniprot: P06791

Protein: E4

Organism: Human papillomavirus type 18

Function

It is responsible for recognition and binding of origin of replication. It exists in two forms such as full length (transcriptional transactivator) and truncated (transcriptional repressor). The ratio of these found in the heterotrimeric complex, formed b

Domain&Motif

method	domain/motif name	position	length	description
CDD	Pap_E4	3424-3681	258	E4 protein; This is is a family of Papillomavirus proteins, E4, coded for by ORF4. A splice variant, E1--E4, exists but neither the function of E4 or E1--E4 is known.
CDD	PHA03416	3421-3681	261	hypothetical E4 protein; Provisional
CDD	PHA03417	3448-3681	234	E4 protein; Provisional
MOTIF_SCAN		3580-3591	12
MOTIF_SCAN		3589-3600	12
MOTIF_SCAN		3640-3651	12
MOTIF_SCAN		3442-3450	9
MOTIF_SCAN		3535-3543	9
MOTIF_SCAN		3577-3585	9
MOTIF_SCAN		3640-3648	9
MOTIF_SCAN		3670-3678	9
MOTIF_SCAN		3424-3681	258
MOTIF_SCAN		3424-3681	258
INTERPROSCAN		3424-3681	258
MOTIF_SEAR_IN_PROT		3424-3681	258
MOTIF_SEAR_IN_PROT		3421-3681	261
MOTIF_SEAR_IN_PROT		3448-3681	234
MOTIF_SEAR_IN_PROT		3424-3681	258
PROSITE_SCAN		3442-3450	9
PROSITE_SCAN		3535-3543	9
PROSITE_SCAN		3577-3585	9
PROSITE_SCAN		3580-3591	12
PROSITE_SCAN		3589-3600	12
PROSITE_SCAN		3640-3648	9
PROSITE_SCAN		3640-3651	12
PROSITE_SCAN		3670-3678	9
SBASE		3424-3681	258
TMPRED_SERVER		3427-3477	51

Sequence

         .         .         .         .         .         .　　　　　G:3477
atgactctatgtgcagtaccagtgacgacacggtatccgctactcagcttgttaaacagc　　　　　C:60
 M  T  L  C  A  V  P  V  T  T  R  Y  P  L  L  S  L  L  N  S 　　　　　P:20


         .         .         .         .         .         .　　　　　G:3537
tacagcacaccccctcaccgtattccagcaccgtgtccgtgggcaccgcaaagacctacg　　　　　C:60
 Y  S  T  P  P  H  R  I  P  A  P  C  P  W  A  P  Q  R  P  T 　　　　　P:20


         .         .         .         .         .         .　　　　　G:3597
gccagacgtcggctgctacacgacctggacactgtggactcgcggagaagcagcattgtg　　　　　C:60
 A  R  R  R  L  L  H  D  L  D  T  V  D  S  R  R  S  S  I  V 　　　　　P:20


         .         .         .         .         .         .　　　　　G:3657
gacctgtcaacccacttctcggtgcagctacacctacaggcaacaacaaaagacggaaac　　　　　C:60
 D  L  S  T  H  F  S  V  Q  L  H  L  Q  A  T  T  K  D  G  N 　　　　　P:20


         .         .                                        　　　　　G:3684
tctgtagtggtaacactacgcctataa                                 　　　　　C:27
 S  V  V  V  T  L  R  L                                     　　　　　P:8

DETAIL

DOMAIN & MUTATION