HPV18 E4

Accession: H000048

NC: NP_040314.1

Uniprot: P06791

Protein: E4

Organism: Human papillomavirus type 18

Function

It is responsible for recognition and binding of origin of replication. It exists in two forms such as full length (transcriptional transactivator) and truncated (transcriptional repressor). The ratio of these found in the heterotrimeric complex, formed b

Sequence&Mutation

         .         .         .         .         .         .　　　　　G:3477
atgactctatgtgcagtaccagtgacgacacggtatccgctactcagcttgttaaacagc　　　　　C:60
 M  T  L  C  A  V  P  V  T  T  R  Y  P  L  L  S  L  L  N  S 　　　　　P:20


         .         .         .         .         .         .　　　　　G:3537
tacagcacaccccctcaccgtattccagcaccgtgtccgtgggcaccgcaaagacctacg　　　　　C:60
 Y  S  T  P  P  H  R  I  P  A  P  C  P  W  A  P  Q  R  P  T 　　　　　P:20


         .         .         .         .         .         .　　　　　G:3597
gccagacgtcggctgctacacgacctggacactgtggactcgcggagaagcagcattgtg　　　　　C:60
 A  R  R  R  L  L  H  D  L  D  T  V  D  S  R  R  S  S  I  V 　　　　　P:20


         .         .         .         .         .         .　　　　　G:3657
gacctgtcaacccacttctcggtgcagctacacctacaggcaacaacaaaagacggaaac　　　　　C:60
 D  L  S  T  H  F  S  V  Q  L  H  L  Q  A  T  T  K  D  G  N 　　　　　P:20


         .         .                                        　　　　　G:3684
tctgtagtggtaacactacgcctataa                                 　　　　　C:27
 S  V  V  V  T  L  R  L                                     　　　　　P:8

DETAIL

EPITOPE & MUTATION